Cucurbit Yellow Stunting Disorder Virus Research Articles

Non-Native Plant Viruses Prevalent in Remnant Natural Plant Communities Harm Native Perennial Hosts

Plant viruses are ubiquitous throughout plant communities, but research on viral impacts largely focuses on crops. Little is known about how viruses influence wild plants in their native habitats. To address this gap, we examined virus interactions with wild drought-tolerant perennials in California desert natural areas encroached upon by agriculture. We used metagenomics, targeted diagnostics, and phylogenetics to assess virus diversity and clade relationships, and experiments to investigate viral influence on hosts. We focused on three herbaceous perennials ( Cucurbita foetidissima, C. palmata, and Datura wrightii) and tested the hypothesis that these wild species accumulate virus infections typically found in crops and transmitted by polyphagous insects. We predicted that such infections might be retained across seasons and potentially impair plant performance. Virome profiling revealed a rich community of previously characterized virus species (12 total), with virus community structure varying by site and host species. The dominant viruses in the wild hosts were non-native crop pathogens, including cucurbit aphid-borne yellows virus (CABYV) and cucurbit yellow stunting disorder virus (CYSDV). Targeted testing revealed that CABYV infected as many as 88% of sampled wild Cucurbita individuals, with dual CABYV–CYSDV infections common in natural areas adjacent to desert agriculture. CABYV infections reduced shoot and root production in greenhouse experiments with the two wild Cucurbita species. Phylogenetic analyses suggest that CABYV was introduced to California multiple times from other continents. Our findings provide concerning evidence of ways in which human activities can alter virus pressure on wild plants and potentially contribute to plant decline.

First report of cucurbit yellow stunting disorder virus infecting cucurbit crops in Jamaica.

The increasing prevalence of whitefly-transmitted viruses affecting cucurbit crops has emerged as a significant concern for global cucurbit production. Two of the most widely prevalent threats in the Americas are cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) (Crinivirus, Closteroviridae). These viruses induce similar foliar symptoms on cucurbit crops (Mondal et al., 2023) leading to loss of photosynthetic capability and decreased yields. Cantaloupe (Cucumis melo), watermelon (Citrullus lanatus), and cucumber (Cucumis sativus) are major cucurbit crops in St. Elizabeth, Jamaica, which is the principal fruit and vegetable producing region of the country. In August 2018, foliar symptoms were observed on cantaloupe, watermelon, and cucumber plants in several commercial farms in St. Elizabeth. These symptoms, mainly on the older leaves, consisted of severe yellowing or interveinal mottle and they appeared more pronounced on cantaloupe and cucumber plants compared to watermelon. Growers noticed the production of smaller than normal fruit. Disease incidence ranged from 10 to 100% and whiteflies (Bemisia tabaci Gennadius) were observed in the fields. To identify virus(es) associated with the disease, six plants (cantaloupe [n = 3], cucumber [n = 1] and watermelon [n = 2) exhibiting symptoms were sampled from four fields for preliminary screening. Total RNA was extracted from leaf tissues as described in Tamang et al. (2021) and samples tested by a multiplex reverse transcription RT-PCR method that targeted the RNA-dependent RNA polymerase (RdRp) of the whitefly transmitted viruses, CYSDV, CCYV, squash vein yellowing virus (SqVYV), and the aphid- transmitted cucurbit aphid-borne yellows virus (CABYV) (Mondal et al. 2023). RT-PCR amplified the expected 494-bp fragment of the CYSDV RdRp gene (Mondal et al., 2023) from two symptomatic plants; one cantaloupe, one cucumber, as well as from CYSDV-infected control plants but not from healthy controls. Further testing was conducted during the June-August 2020 growing season after similar symptoms were observed on additional farms in St. Elizabeth and two regions, Manchester and Clarendon, located to the east of St. Elizabeth. Twenty-one cucurbit leaf samples (11 cantaloupe, seven watermelon and two cucumber from St. Elizabeth and one cantaloupe from Clarendon) exhibiting foliar yellowing progressing from the crown outward, and mottling were collected. Whiteflies (5) from these fields in St. Elizabeth and 20 asymptomatic weed samples were also collected and sent to the USDA-ARS laboratory at Salinas, CA. Total RNA from leaf samples was extracted as described above and tested for CYSDV, CCYV, and CABYV. Total leaf DNA was also extracted (Mondal et al. 2016) and assayed with PCR (Gilbertson 2001) to detect the presence of the whitefly-transmitted cucurbit leaf crumple virus (CuLCrV), a begomovirus, commonly found in the southeastern United States (Gadhave et al., 2018; Keinath et al., 2018). Nineteen of the 21 cucurbit samples tested positive for the presence of CYSDV by RT-PCR (Mondal et al. 2023). Of the 19 CYSDV-positive samples, 13 cantaloupe, one cucumber, and five watermelon samples were singly infected with CYSDV, and one cantaloupe sample was infected with both CYSDV and CABYV. Amplicons of the Jamaica isolate from cantaloupe were sequenced (OR399555) and a 494 nt section of the RdRp gene was found to share 100% sequence identity to the Arizona 1 isolate (EF547827.1). The presence of CYSDV, was further confirmed using a second set of primers that amplified a 394-nt portion of the CYSDV coat protein gene (Polston et al., 2008). Among the weed samples, CABYV was detected in one sample from a Leonotis nepetifolia plant (Lamiaceae) and two Cleome sp. (Capparaceae) collected from St. Elizabeth. None of the crop and weed samples tested positive for CCYV or CuLCrV. DNA from whiteflies was extracted and assayed with PCR using species specific primers (Chen et al. 2016). All whiteflies were identified as B. tabaci cryptic species MEAM1, which is widely known an efficient vector of CYSDV (Berdiales, et al. 1999). This is the first report of CYSDV in Jamaica and its first known occurrence in these hosts within the country. Further monitoring of cucurbit crops and the whitefly vector is warranted to better understand the epidemiology.

First Report of Cucurbit aphid-borne yellows virus infecting five cucurbits in India.

Cucurbits are among the most popular vegetables cultivated globally. They have high economic importance, especially in India, where they are cooked and eaten as vegetables (Dhillon et al. 2016). In February 2023, yellowing symptoms were observed on cucurbitaceous species, viz. Trichosanthes cucumerina (Snake gourd - SG), Luffa acutangula (Ridge gourd - RG), Lagenaria siceraria (Bottle gourd - BG), Luffa aegyptiaca (Sponge gourd - SPG) and yellow chlorotic spots were recorded on Benincasa hispida (Ash gourd - AG) growing in the experimental farm at the Indian Agricultural Research Institute, Regional Station, Pune (Supplementary Figure 1). The average disease incidence ranged from 5% to 30%. A total of 175 leaf samples, including thirty symptomatic and five asymptomatic plants of each cucurbit, were collected and tested by DAS-ELISA using antisera against cucurbit aphid-borne yellows virus (CABYV) (DSMZ, Germany), cucurbit yellow stunting disorder virus (CYSDV) (Arsh Biotech, India), cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), and papaya ringspot virus (PRSV) (Agdia, USA). All 150 symptomatic cucurbit samples tested positive for CABYV, while five samples from SG, 14 from RG, two from AG, and 11 from SPG hosts were also positive for PRSV. Asymptomatic samples were negative for all viruses tested. In order to further confirm the presence of the virus, total RNA was extracted from ten samples of each cucurbit host that were positive only for CABYV and the asymptomatic samples using the RNeasy Plant Mini Kit (Qiagen, Germany) as per the manufacturer's protocol. Two-step RT-PCR was carried out using the extracted RNA and CABYV-specific primers, amplifying c. 484 bp of the coat protein gene region (Boubourakas et al. 2006). Amplicons of expected size were obtained in all symptomatic samples, whereas the asymptomatic samples tested negative. Three amplicons obtained from positive samples from each of the cucurbit species were directly sequenced and found to be identical to each other. A representative virus sequence obtained from each cucurbit was deposited in GenBank (Snake gourd - OQ921128, Ridge gourd - OQ921127, Bottle gourd - OQ921126, Ash gourd - OQ921125, Sponge gourd - OQ921129). In BLASTn analysis, the isolates shared from 94.23 to 100% nucleotide identities with the Indian CABYV isolates of various cucurbits and clustered closely with other Pune isolates in the phylogenetic analysis (Supplementary Figure 2). CABYV (genus Polerovirus) is a single-stranded positive-sense RNA virus, and is known to infect and cause severe economic losses in cucurbits worldwide. Previously, occurrences of CABYV have been reported in cucurbits such as watermelon, bitter gourd, cucumber, squash, teasel gourd, and muskmelon in India (Nagendran et al. 2022; Tripathi et al. 2023). It has also been reported to infect a weed species - Abelmoschus moschatus from the same geographical region (Verma et al. 2023). To our knowledge, this is the first report of the natural occurrence of CABYV in snake gourd and ridge gourd worldwide and bottle gourd, ash gourd and sponge gourd in India. The present findings have significant epidemiological importance, as they demonstrate that CABYV is spreading to other cucurbits and occurring widely in India.

First Detection of Cucurbit Yellow Stunting Disorder Virus in Iraq

During the growing season of 2022, courgette plants displaying foliar yellowing that included leaf mottle and interveinal chlorosis along with green veins were observed in numerous courgette fields of Al-Yusufiyah, Baghdad Province, Iraq. Bemisia tabaci was abundant with the foliar yellowing plants in all fields investigated. Fifty symptomatic leaf samples showing typical foliar yellowing were collected randomly from several courgette fields. Three representative samples were sent to Macrogen (Seoul, South Korea) for high-throughput RNA sequencing. The BLASTn analyses of the assembled genome of cucurbit yellow stunting disorder virus (CYSDV) isolate Iraq-1 segment RNA1 and RNA2 demonstrated pairwise nucleotide identity between 99.23 and 99.84% for segment RNA1 and between 97.58 and 97.92% for segment RNA2 with several corresponding global isolates of CYSDV. These two segments of the CYSDV isolate Iraq-1 were deposited in GenBank under accession numbers OQ685958.1 and OQ685959.1, respectively. Additionally, a phylogenetic analysis indicated a relationship between CYSDV isolate Iraq-1 and numerous isolates of CYSDV reported from various origins, mainly from the United States (MW147553.1 and EF547827.1) and Spain (AJ537493.1 and NC_004809) for the segment RNA1. However, the segment RNA2 of CYSDV isolate Iraq-1 was close to those from Spain (NC_004810.1, AY242078.1, and AJ439690.2), Greece (OL584360.1), and the United States (FJ492808.1). Although CYSDV was previously reported in Europe, such as in Spain and France; in Asia in Iran and Jordan; and in North America in the United States and Mexico, it has not been reported in Iraq. Thus, this is the first report of CYSDV in Iraq.

Distribution and Incidence of Watermelon Crinkle Leaf-Associated Virus 1, Watermelon Crinkle Leaf-Associated Virus 2, and Other Viruses in Cucurbits in South Florida

A survey of cucurbits grown in South Florida was conducted from 2020 to 2022 for viruses. A total of 481 plant samples (470 cucurbit and 11 noncucurbit) included watermelon, squash, cantaloupe, cucumber, zucchini, five weeds commonly found in cucurbit fields, and two vegetable volunteer plants growing in a watermelon field. Samples were tested for cucurbit chlorotic yellows virus, squash vein yellowing virus, papaya ringspot virus-W, watermelon crinkle leaf-associated virus 1 (WCLaV-1), watermelon crinkle leaf-associated virus 2 (WCLaV-2), cucurbit yellow stunting disorder virus (CYSDV), and cucurbit leaf crumple virus. All seven viruses were detected with WCLaV-1 as the predominant virus found in cucurbits, followed by CYSDV and WCLaV-2. The majority of samples were mixed infections containing two or more viruses. Host tissue testing found the peduncle was a good source for testing for all viruses. Host symptoms were variable on leaves for WCLaV-1 and WCLaV-2 and in mixed infections with the other five viruses. More studies are required to ascertain the role of WCLaV-1 and WCLaV-2 in mixed infections and their effects on plant health, fruit quality, and yield.

A Comprehensive Review on Cucurbits Yellow Stunting Disorder Virus (CYSDV) and their Management

Cucurbit Yellow Stunting Disorder Virus (CYSDV) represents a significant threat to global agriculture, particularly impacting the cultivation of cucurbit crops such as melons, squashes, and cucumbers. This comprehensive review explores the various dimensions of CYSDV, including its taxonomy, epidemiology, pathogenesis, diagnostic methods, management, ongoing research, and the broader social and economic implications. Beginning with an examination of CYSDV's classification and morphology, the review delineates the geographical distribution of the virus, its host range, transmission vectors, and environmental factors influencing its spread. It also outlines the mechanisms of infection, stages of disease development, symptoms in various cucurbit species, and the economic impact of the disease. The discussion extends to both traditional and molecular diagnostic techniques and the associated challenges. Different strategies for managing and controlling CYSDV are highlighted, including cultural practices, chemical methods, biological control, and integrated pest management approaches. The review emphasizes ongoing research initiatives and future perspectives in CYSDV research, considering technological innovations and potential limitations. The final sections focus on the broader social and economic context, exploring the impact of CYSDV on small and large-scale farming, international trade considerations, community engagement, and government initiatives. Through an integrated analysis, this review provides valuable insights into the multifaceted nature of CYSDV, its influence on agriculture, and the wider societal dynamics. The conclusion underscores the necessity of a coordinated, comprehensive approach that leverages scientific research, international collaboration, community involvement, and governmental support to address the challenges posed by CYSDV. Understanding the complexities of this virus is essential for developing effective strategies to ensure food security and economic stability in regions affected by this detrimental plant disease.

Emergence of yellowing disease in cucurbitaceous vegetables caused by Crinivirus and Polerovirus in India

Totally 102 symptomatic samples of cucurbitaceous vegetables showing yellowing were collected from fields of Uttar Pradesh and screened by RT-PCR assay for the presence of Crinivirus and Polerovirus. Among them, Crinivirus (16%) and Polerovirus (23%) were tested positive with the universal primer pairs. Based on the sequence analysis of amplified product, two Crinivirus (Cucurbit chlorotic yellows virus - CCYV and Cucurbit yellow stunting disorder virus - CYSDV) and two Polerovirus (Cucurbit aphid-borne yellows virus - CABYV and Luffa aphid-borne yellows virus - LABYV) species were characterized. Phylogenetic analysis revealed less genetic distance among the Indian isolates of CCYV, CYSDV and LABYV whereas CABYV closely related to Chinese isolates. To the best of our knowledge, this study documents infection of CCYV on cucumber, round melon and muskmelon; CYSDV on satputia and sponge gourd; CABYV on ivy gourd; and LABYV on ridge gourd, satputia and muskmelon for the first time in India.

Effects of Host Plants and Their Infection Status on Acquisition and Inoculation of A Plant Virus by Its Hemipteran Vector.

Whitefly, Bemisia tabaci Gennadius (B cryptic species), transmits cucurbit leaf crumple virus (CuLCrV) in a persistent fashion. CuLCrV affects several crops such as squash and snap bean in the southeastern United States. CuLCrV is often found as a mixed infection with whitefly transmitted criniviruses, such as cucurbit yellow stunting disorder virus (CYSDV) in hosts such as squash, or as a single infection in hosts such as snap bean. The implications of different host plants (inoculum sources) with varying infection status on CuLCrV transmission/epidemics is not clear. This study conducted a series of whitefly mediated CuLCrV transmission experiments. In the first experiment, three plants species: squash, snap bean, and tobacco were inoculated by whiteflies feeding on field-collected mixed-infected squash plants. In the second experiment, three plant species, namely squash, snap bean, and tobacco with varying infection status (squash infected with CuLCrV and CYSDV and snap bean and tobacco infected with CuLCrV), were used as inoculum sources. In the third experiment, squash plants with differential CuLCrV accumulation levels and infection status (either singly infected with CuLCrV or mixed infected with CuLCrV and CYSDV) were used as inoculum sources. Irrespective of plant species and its infection status, CuLCrV accumulation in whiteflies was dependent upon the CuLCrV accumulation in the inoculum source plants. Furthermore, differential CuLCrV accumulation in whiteflies resulted in differential transmission, CuLCrV accumulation, and disease phenotype in the recipient squash plants. Overall, results demonstrate that whitefly mediated CuLCrV transmission between host plants follows a virus density dependent phenomenon with implications for epidemics.

Differential seasonal prevalence of yellowing viruses infecting melon crops in southern California and Arizona determined by multiplex RT-PCR and RT-qPCR.

Viruses transmitted by the whitefly (Bemisia tabaci) are an increasing threat to cucurbit production in the southwestern United States as well as many other cucurbit production regions throughout the world. The crinivirus, cucurbit yellow stunting disorder virus (CYSDV), has severely impacted melon production in California and Arizona since its introduction to the region in 2006. Within the past few years, another crinivirus, cucurbit chlorotic yellows virus (CCYV), and the whitefly-transmitted ipomovirus, squash vein yellowing virus (SqVYV) were found infecting melon plants in California's Imperial Valley as well. Both CYSDV and CCYV, as well as an aphid transmitted polerovirus, cucurbit aphid-borne yellows virus (CABYV), occur together in the region and produce identical yellowing symptoms on cucurbit plants. Mixed infections of these four viruses both in the Sonoran Desert and other regions pose challenges for disease management and efforts to develop resistant varieties. A multiplex single-step RT-PCR method was developed that differentiates these viruses from one another, and this was used to determine the prevalence and distribution these viruses in melon samples collected from fields in the Sonoran Desert melon production region of California and Arizona, USA during spring and fall melon seasons from 2019 through 2021. TaqMan probes were also developed, optimized, and applied in a single-step multiplex RT-qPCR to quantify titers of these four viruses in plant samples, which frequently carry mixed infections. Results of the multiplex RT-PCR analysis demonstrated that CYSDV is the predominant virus during the fall season, whereas CCYV was by far the most prevalent virus during spring seasons each year. Multiplex RT-qPCR was used to evaluate differential accumulation and spatio-temporal distribution of viruses within plants and suggested differences in competitive accumulation of CCYV and CYSDV within melon. This study also provides the first official report of SqVYV in Arizona, USA, and offers an efficient method for virus detection and quantification for breeding and disease management in areas impacted by cucurbit yellowing viruses.

Development of a multiplex RT-RPA assay for simultaneous detection of three viruses in cucurbits.

Begomoviruses and criniviruses, vectored by whiteflies (Bemisia tabaci), are important threats to crops worldwide. In recent years, the spread of cucurbit leaf crumple virus (CuLCrV), cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) on cucurbit crops has been reported to cause devastating crop losses in many regions of the world. In this study, a multiplex recombinase polymerase amplification (RPA) assay, an isothermal technique for rapid and simultaneous detection of DNA and RNA viruses CuLCrV, CYSDV and CCYV was developed. Highly specific and sensitive multiplex RPA primers for the coat protein region of these viruses were created and evaluated. The sensitivity of the multiplex RPA assay was examined using serially diluted plasmid containing the target regions. The results demonstrated that multiplex RPA primers have high sensitivity with a detection limit of a single copy of the viruses. The multiplex RPA primers were specific to the target as indicated by testing against other begomoviruses, potyviruses and an ilarvirus, and no nonspecific amplifications were noted. The primers simultaneously detected mixed infection of CCYV, CYSDV and CuLCrV in watermelon and squash crude extracts. This study is the first report of a multiplex RPA assay for simultaneous detection of mixed infection of DNA and RNA plant viruses.

First Report of Tomato Leaf Curl New Delhi Virus Infecting Several Cucurbit Plants in China

In autumn 2022, a novel and devastating viral disease affecting cucurbits emerged in Ningbo (Zhejiang province), Haimen (Jiangsu province), and Shanghai, China, causing an approximate 650-hectare infestation and resulting in nearly US$15 million in economic losses. The incidence rates of infection reached up to 72.5% on muskmelon (Cucumis melo L. ssp melo), oriental melon (Cucumis melo L. var. agrestis), pumpkin (Cucurbita moschata), luffa (Luffa acutangula), and squash (Cucurbita pepo), and were highly associated with the presence of whitefly (Bemisia tabaci). Infected plants exhibited symptoms such as dwarf stunting, reduced leaf size, leaf chlorotic patches, malformation, fruit deformation, leaf downward rolling, and yellowing (Figure 1). To identify the pathogen, forty cucurbit leaf samples were collected from Haimen (18), Ningbo (19), and Shanghai (3) and tested for cucurbits chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and Begomovirus using RT-PCR or PCR. All samples tested negative for CCYV and CYSDV using species-specific primers; however, 29 out of 40 samples tested positive (see Supplementary Table 1) for Begomovirus using the degenerate primer pairs PA/PB (Deng et al. 1994). PCR products from seven samples, representing different regions and hosts, underwent Sanger sequencing. The nucleotide sequences of these products showed 98.2-99% identity to tomato leaf curl New Delhi virus (ToLCNDV) by BLASTn. Subsequently, the 29 positive cucurbit samples were confirmed using ToLCNDV-specific primer pairs NDVAF/NDVAR and NDVBF/NDVBR (Jyothsna et al. 2013) for DNA-A and DNA-B, respectively. The DNA-A and DNA-B genome sequences of ToLCNDV isolates from Haimen (Haimen4), Ningbo (Ningbo6), and Shanghai (Shanghai1) were obtained using the primer pairs NDVAF/NDVAR, A1961F/A2645R (covering complete DNA-A sequences), NDVBF/NDVBR, and B1613F/B2579R (covering complete DNA-B sequences，see Supplementary Table 2). No amplicon was produced with primer pairs UNA101/UNA102 and beta01/beta02 (Supplementary Table 2) for detecting Alphasatellite and Betasatellite DNAs, respectively. The complete DNA-A genome sequences (2739 bp) of Haimen 4 (accession no. OP585369), Ningbo 6 (accession no. OP585370), and Shanghai 1 (accession no. OP683993) isolates exhibited 99.5-99.6% nucleotide identity to each other, and their highest nucleotide sequence identity (99.3-99.4%) was shared with the DNA-A of ToLCNDV-Zhejiang isolate (accession no. OP356207) from tomato in Zhejiang Province, China. The complete nucleotide sequences (2693 nt) of DNA-B for Haimen 4 (accession no. OP683995), Ningbo 6 (accession no. OP683996), and Shanghai 1 (accession no. OP683994) isolates showed 99.0-99.1% identity to each other, and their highest nucleotide sequence identity (~99.1%) was shared with the DNA-B of ToLCNDV-Zhejiang isolate (accession no. OP356208).All ToLCNDV isolates from mainland China, including the Zhejiang isolate and the three isolates in this study, shared 98.3-98.7% nucleotide sequence identity and 98.2-98.4% with the DNA-A genome of the severe isolate (accession no. HM159454) from tomato in New Delhi, India, and the DNA-B genome of the India:Delhi:Cucumis:2012 isolate from cucumber in New Delhi, India, respectively. However, the genome sequence identities between mainland and Taiwan isolates (accession nos. GU180095 and GU180096) were below 93%, suggesting that mainland China isolates of ToLCNDV are more closely related to the India isolate than to the Taiwan isolate.To fulfill Koch's postulates, infectious clones of the Haimen 4 isolate were constructed and agroinfiltrated into muskmelon, oriental melon, pumpkin, luffa, and squash plants. In brief, two plasmids, containing 1.56-mer DNA-A and 1.4-mer DNA-B genome sequences, were constructed using enzyme digestion and ligation, transformed into Agrobacterium tumefaciens strain GV3101, respectively, and then co-agroinfiltrated into cucurbit plants. Initial symptoms appeared in the new leaves at 7 days post-inoculation (DPI), followed by severe leaf curling, dwarfing, stunting, reduced leaf size, and chlorotic leaf patches at 18 DPI. The presence of DNA-A and DNA-B of ToLCNDV in inoculated plants was confirmed by PCR using primer pairs A1961F/A2645R and B1613F/B2579R, respectively. Collectively, the pathogen of this emerging disease has been identified as ToLCNDV. ToLCNDV was first reported on tomato in India and is now the most predominant and economically significant disease affecting cucurbit and solanaceous crops in Southeast and East Asia, the Middle East, and the Mediterranean Basin (Moriones et al. 2017). In China, ToLCNDV was initially reported on oriental melon in Taiwan (Chang et al. 2010) and subsequently on tomato (Lycopersicon esculentum) in Zhejiang province (Li et al. 2022). To the best of our knowledge, this is the first report of ToLCNDV infecting muskmelon, pumpkin, luffa, and squash in China. Further investigations on the epidemiology of this viral disease in China are needed.

Musk mallow (Abelmoschus moschatus): a new host of Cucurbit aphid‐borne yellows virus

Musk mallow (Abelmoschus moschatus, family Malvaceae) is a medicinal plant cultivated across Asia, Africa and South America. It is found as a weed all over the Deccan region of India (Pawar & Vyawahare, 2017). The seeds of the plant are used for medicinal purposes and as a source of fragrant compounds (Gul et al., 2011). Musk mallow plants exhibiting yellowing of older leaves, midvein clearing, leaf reduction, mottling and slight downward curling (Fig. 1) were observed in October 2022 at the experimental research farm of the Indian Agricultural Research Institute in Pune, Maharashtra, India. The plants occurred as weeds and the disease incidence was 4% (c. 16 plants) in an eight-acre area. Ten diseased and four asymptomatic plants were sampled to ascertain the viruses associated with the symptoms. ELISA was done using antisera against Cucurbit aphid-borne yellows virus (CABYV) (DSMZ, Germany), Cucurbit yellow stunting disorder virus (CYSDV) (Arsh Biotech, India), Cucumber mosaic virus (CMV), Papaya ringspot virus (PRSV) and Zucchini yellow mosaic virus (ZYMV) (Agdia, USA). CABYV was detected in all diseased samples but CMV, CYSDV, PRSV and ZYMV were not detected. None of the five viruses were detected by ELISA in the asymptomatic samples. Total RNA was extracted from both diseased and asymptomatic samples using an RNeasy Plant Mini Kit (Qiagen, USA). Two-step RT-PCR assay was done using the extracted RNA and CABYV-specific primers which amplify c. 484 bp of the partial coat protein region (Boubourakas et al., 2006). RT-PCR was also performed using primers specific for CMV, CYSDV, PRSV, ZYMV, Beet pseudo-yellows virus and Cucumber vein yellowing virus. Amplicons of the expected size were obtained in all diseased plants with CABYV primers but not with primers for any of the other viruses. No amplification was obtained in the asymptomatic samples for any of the viruses. The amplicons of five samples were Sanger sequenced bidirectionally and found to be identical (GenBank Accession No. OP455156). A BLASTn search of the sequence revealed that it shared 100% identity with an Indian CABYV sequence from Praecitrullus fistulosus (OP455157). A phylogenetic tree was constructed using the neighbour-joining method (MEGA X program) with CABYV sequences from different hosts and geographies, and the sequence clustered with other Indian CABYV sequences (Fig. 2). CABYV primarily infects cucurbits but also infects other crops and weeds including three Malvaceae species, Abutilon theophrasti, Gossypium hirsutum and Malva parviflora (Lecoq et al., 2022). To our knowledge, this is the first report of CABYV infecting Abelmoschus moschatus in the world. The present finding is of epidemiological importance as it indicates the further broadening of the host range of CABYV and the possibility of infecting other economically important Malvaceae members, such as G. hirsutum which is grown for cotton in India. Furthermore, musk mallow plants could serve as an alternative / reservoir host for CABYV aiding its transmission to other commercial crops. The authors thank the Director, ICAR-IARI, New Delhi for providing lab facilities.

Research on Drawing Attention to Overlooked Viruses in Plant Viruses Causing Yellowing-Type Symptoms in Cucurbitaceae

A single-stranded, positive-sense plant RNA virus called the Cucurbit chlorotic yellows virus (CCYV, Crinivirus, Closteroviridae) is comprised of RNA1 and RNA2. It is semipersistently transmitted by the whitefly Bemisia tabaci biotypes MEAM1 and MED. In 2004, CCYV was discovered on melon plants in Japan. Several other cucurbit species, as well as a range of non-species, were subsequently reported from countries such as Saudi Arabia, California, Israel, Taiwan, Sudan, Lebanon, Iran, Greece, Türkiye, Egypt, Spain, and China. Whitefly populations are frequently encountered in cucurbit cultivating areas. Virus plant diseases attributed to whiteflies are common in squash cultivation in the open field and greenhouses in Türkiye, especially in cucumbers and squash. Cucumber vein yellowing virus (CVYV), Cucurbit yellow stunting disorder virus (CYSDV), Tomato leaf curl New Delhi virus (ToLCNDV), Squash vein-yellowing virus (SqVYV) are the leading virus diseases transmitted by Bemisia tabaci. Symptoms caused specifically by these viral diseases are of the yellowing type, although they differ as intervascular yellowing, yellowing of old or young leaves, and upward curling. Besides these viruses, CCYV, a problem in cucurbits, is carried by whitefly like others, causes yellowing type symptoms, and its first record in cucumber was reported in 2017 in Türkiye. However, this virus is ignored in the production of cucurbits, it is a problem in production areas. There are major viruses cause similar symptoms with the presence of the Cucumber chlorotic yellows virus is overlooked in the symptomatological observation. In this study, we tried to reveal the difference of CCYV, which is encountered in cucurbit growing areas in Antalya and whose presence was detected by RT-PCR, from other viruses and emphasized its importance as a virus that should be considered in classical breeding studies.

Small RNA Profiling of Cucurbit Yellow Stunting Disorder Virus from Susceptible and Tolerant Squash (Cucurbita pepo) Lines

RNA silencing is a crucial mechanism of the antiviral immunity system in plants. Small RNAs guide Argonaut proteins to target viral RNA or DNA, preventing virus accumulation. Small RNA profiles in Cucurbita pepo line PI 420328 with tolerance to cucurbit yellow stunting disorder virus (CYSDV) were compared with those in Gold Star, a susceptible cultivar. The lower CYSDV symptom severity in PI 420328 correlated with lower virus titers and fewer sRNAs derived from CYSDV (vsRNA) compared to Gold Star. Elevated levels of 21- and 22-nucleotide (nt) size class vsRNAs were observed in PI 420328, indicating more robust and efficient RNA silencing in PI 420328. The distribution of vsRNA hotspots along the CYSDV genome was similar in both PI 420328 and Gold Star. However, the 3' UTRs, CPm, and p26 were targeted at a higher frequency in PI 420328.

First Report of Cucurbit Chlorotic Yellows Virus Affecting Squash and Pumpkin in Florida

A field survey was conducted in Florida during 2020-2021 in squash and pumpkin research fields to identify the viruses associated with leaf symptoms of yellowing, crumpling, and vein yellowing. The symptoms were similar to previously reported whitefly transmitted viruses such as cucurbit leaf crumple virus (CuLCrV), cucurbit yellow stunting disorder virus (CYSDV), and squash vein yellowing virus (SqVYV). Another potential virus of interest was the cucurbit chlorotic yellows virus (CCYV) that was recently reported on watermelon in Florida. Symptomatic leaves were tested by RT-PCR with coat protein (CP) gene-specific (GS) primers for CuLCrV, CYSDV, CCYV, and SqVYV with nuclear inclusion protein (NIa) GS primers. Amplifications for CuLCrV, CYSDV, and CCYV were detected in squash and pumpkin samples. The CCYV amplicons were further sequenced and compared with available CCYV sequences. The NCBI BLAST analysis revealed similarities of the RdRP (100%), HSP70h (99.75%), and CP (99.75%) to the Shanghai CCYV isolates (RNA KY400636 and RNA2 KY400633). To our knowledge, this is the first report of CCYV on squash and pumpkin in Florida.

Hatay ilinde yetişen Cucurbitaceae familyasına ait kültür bitkilerinde bazı virüslerin DAS-ELISA ve RT-PCR yöntemleriyle saptanması ve moleküler karakterizasyonu

Amaç: Bu çalışmada, Hatay ilinde yetiştirilen hıyar, kabak ve kavun bitkilerinde cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV) ve beet pseudo-yellows virus (BPYV)’lerinin Double Antibody Sandwich-Enzyme Linked Immuno Sorbent Assay (DAS-ELISA) ve Reverse Transcription-Polymerase Chain Reaction (RT-PCR) yöntemleriyle belirlenmesi, elde edilen virüs izolatlarının filogenetik ilişkilerinin ortaya konulması amaçlanmıştır. Yöntem ve Bulgular: Hatay ilinden simptomlu ve simptomsuz 90 adet hıyar, kabak ve kavun örneği toplanmıştır. CCYV’nin varlığını araştırmak için DAS-ELISA ve RT-PCR yöntemleri, CYSDV ve BPYV’lerinin varlığını araştırmak için ise RT-PCR yöntemi kullanılmıştır. Gözlenen en yaygın simptomlar yapraklarda küçülme, deformasyon, yaprak kırışıklıkları, kıvrılmalar ve damar açılmalarıdır. DAS-ELISA testi sonuçlarına göre testlenen örneklerde CCYC bulunamamıştır. RT-PCR analizleri sonucunda testlenen örneklerde BPYV ve CCYV bulunamamış ancak CYSDV’nin heat shock protein 70h (HSP70h) genini çoğaltan 364 bp büyüklüğünde PCR amplikonları 11 örnekte (9 kabak, 2 kavun) elde edilmiştir. Bu ürünlerden 10 tanesinin doğrudan iki yönlü sekans analizi sonucunda, elde edilen nükleotit dizilerinin gen bankasında kayıtlı CYSDV izolatları ile yüksek oranda (%99) benzerlik gösterdiği saptanmıştır. Bu çalışma ile CYSDV ilk defa Hatay ilinde kabak ve kavun bitkilerinde rapor edilmiştir. Genel Yorum: Hatay ili kabak ve kavun alanlarından toplanan örneklerde CYSDV ilk kez tespit edilmiştir. Testlenen örneklerinin hiçbirinde BPYV ve CCYV belirlenememiştir. Testlenen örneklerin %12.22 oranında CYSDV ile enfekteli bulunması, sağlıklı bitki materyallerinin kullanılmasının önemini göstermektedir. Çalışmanın Önemi ve Etkisi: Hatay ilinde ilk kez bu çalışma ile kabak ve kavun bitkilerinde CYSDV’ünün varlığı, RT-PCR analizleri ile kanıtlanmıştır.

First report of Cucurbit aphid-borne yellows virus causing yellowing disease on pumpkin (Cucurbita pepo) and cucumber (Cucumis sativus) in Bulgaria.

Cucurbit aphid-borne yellows virus (CABYV) was first reported in France in 1992 but has since been observed worldwide (Lecoq et al. 1992; Choi and Choi 2016; Buzkan et al. 2017; Zindovic et al. 2017; Vidal et al. 2018; Khanal and Ali, 2018). This virus has caused severe losses to different crops especially to the members of Cucurbitaceae and yield losses can reach up to 40-50% if infection occurs at early stages (Lecoq et al. 1992). In July 2017, leaf samples showing virus-like symptoms were collected from five pumpkin (Cucurbita pepo L. var. Clypeata Alefield) and two cucumber (Cucumis sativus L. cv. Azuma matsunari) plants, growing in а field near Sadovo, Bulgaria. Nearly all plants in the field were affected and displayed green or yellow mosaic, interveinal yellowing, blisters, and leaf deformation (Fig. 1). The collected samples were all symptomatic and were subjected to double antibody sandwich (DAS) or triple antibody sandwich (TAS) enzyme-linked immunosorbent assay (ELISA) to determine the viral agent(s). Specific monoclonal antibodies (Leibniz institute DSMZ, Germany) raised against Cucumber leaf spot virus, Cucurbit chlorotic yellows virus, Cucurbit yellow stunting disorder virus, Cucumber mosaic virus (CMV), Melon necrotic spot virus, Beet western yellows virus (BWYV), CABYV, Watermelon mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV), and Cucumber green mottle mosaic virus, were used. The total number of tested samples was seven (n=5 from pumpkin and n=2 from cucumber). All of them displayed positive signals for CABYV and BWYV, both belonging to genus Polerovirus, family Luteoviridae. In addition, ZYMV and/or WMV were detected in pumpkins while CMV and/or WMV were detected in cucumber samples, respectively. To confirm the presence of CABYV and/or BWYV, total RNA was isolated from all seven samples by TRI Reagent® (Sigma, St. Louis, USA) and converted to cDNA with First Strand cDNA Synthesis Kit, Thermo Scientific™. Reverse transcription (RT)-polyemerase chain reaction (PCR) was performed using two pairs of primers (CABYV1FW: 5'-TTATCAGGGGACTATGTTTA-3' and CABYV14REV: 5'-GAGGGGATTTTAACTGACTG-3', and BWYV1FW: 5'-AGTAAGTCCTCCCCAACTGA-3' and BWYV2REV: 5'-CTACCCACGACCGTATTCAT-3'), specifically designed to detect CABYV and BWYV, respectively. Amplicons with expected sizes of 1,930 bp were obtained only with CABYV primers for all samples while no fragments were amplified with BWYV primers. The obtained products from two samples (pumpkin and cucumber) were purified and sent to Macrogen Inc., South Korea, for direct sequencing in both directions. High quality nucleotide sequences were submitted to GenBank We have evaluated the quality of the sequencing and trimmed those parts that did not comply the needed quality. The obtained smaller fragments Nucleotide sequences were submitted to GenBank with accession numbers MK671010 (656 bp) and MK671014 (712bp). These sequences contained ORFs encoding CABYV P1-P2 fusion proteins as determined by Blastp analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins). A phylogenetic tree constructed by the Neighbor-joining method using 18 CABYV accessions and Potato leafroll virus as an outlier (Fig. 2) showed that the closest accessions to MK671010 and MK671014 were NC003688 (France) and EU636992 (China) with respective nucleotide identity of 98% and 99%. In 2019, another outbreak was observed in the same field near Sadovo and in a field near Plovdiv planted with pumpkins. Nearly 30% of the plants showed leaf yellowing typical for Polerovirus infection. Screening of collected samples (n=17) by RT-PCR confirmed CABYV presence in 15 samples. Based on available reports and according to our knowledge this is the first report of CABYV in Bulgaria.

First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state's economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5'TCCACAAGCTTGATGGA- GGG3') and WCLaV-1RP (5'TCCCGAGTGAGGAAGCTAGT3'). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.

Persistent, and Asymptomatic Viral Infections and Whitefly-Transmitted Viruses Impacting Cantaloupe and Watermelon in Georgia, USA.

Cucurbits in Southeastern USA have experienced a drastic decline in production over the years due to the effect of economically important viruses, mainly those transmitted by the sweet potato whitefly (Bemisia tabaci Gennadius). In cucurbits, these viruses can be found as a single or mixed infection, thereby causing significant yield loss. During the spring of 2021, surveys were conducted to evaluate the incidence and distribution of viruses infecting cantaloupe (n = 80) and watermelon (n = 245) in Georgia. Symptomatic foliar tissues were collected from six counties and sRNA libraries were constructed from seven symptomatic samples. High throughput sequencing (HTS) analysis revealed the presence of three different new RNA viruses in Georgia: cucumis melo endornavirus (CmEV), cucumis melo amalgavirus (CmAV1), and cucumis melo cryptic virus (CmCV). Reverse transcription-polymerase chain reaction (RT-PCR) analysis revealed the presence of CmEV and CmAV1 in 25% and 43% of the total samples tested, respectively. CmCV was not detected using RT-PCR. Watermelon crinkle leaf-associated virus 1 (WCLaV-1), recently reported in GA, was detected in 28% of the samples tested. Furthermore, RT-PCR and PCR analysis of 43 symptomatic leaf tissues collected from the fall-grown watermelon in 2019 revealed the presence of cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and cucurbit leaf crumple virus (CuLCrV) at 73%, 2%, and 81%, respectively. This finding broadens our knowledge of the prevalence of viruses in melons in the fall and spring, as well as the geographical expansion of the WCLaV-1 in GA, USA.

Occurrence of cucurbit yellow stunting disorder virus causing yellowing disease of cucurbits in India

Cucurbitaceous crops are major vegetable group cultivated widely in India. Leaves of cucumber, bitter gourd and watermelon were observed with virus like yellowing symptoms of interveinal chlorosis. DAS-ELISA and RT-PCR assay were performed to identify the infecting virus. Nucleotide sequence analysis confirmed the association of Cucurbit yellow stunting disorder virus (CYSDV), a Crinivirus belonging to family Closteroviridae. This study documented the prevalence of CYSDV on cucurbitaceous crops for the first time from India.